Chromosome 16q22-linked familial AML: Exclusion of candidate genes, and possible disease risk modification by NQO1 polymorphisms
| Table 2. Probes used for Northern Blot experiments. | |||
| Gene | Probes | ||
| Template for probe generation | primers for probe generation | gene coverage | |
| CTCF |
5'- GACTGTCTCTGGACCGCTATCTAA and 3'- TTGAAGTTTTCGTTCTCGGTATGT primers were used on BAC clone RP11-167P11, and the PCR product was inserted into pCR2.1-TOPO (Invitrogen) | M13 (-20) Forward primer M13 Reverse Primer |
exon 12- 3' UTR |
| E2F4 |
IMAGE EST clone ID 786048 (Unigene Cluster Hs.108371) vector pT3T7-Pac | M13 (-20) Forward primer M13 Reverse Primer |
exon 8-3'UTR |
| NFATC3 |
IMAGE EST clone ID 727192 (Unigene Cluster Hs.172674) vector pT7T3D-Pac | M13 (-20) Forward primer M13 Reverse Primer |
exon 9-3'UTR |
| NFAT5 |
IMAGE EST clone ID 753973 (Unigene Cluster Hs.86998) vector pT3T7-Pac | M13 (-20) Forward primer M13 Reverse Primer |
exon 14 |
Last modified on the 20th February 2004.
For comments regarding the content of this page, please contact or