No evidence for core-binding factor CBFβ as a leukemia predisposing factor in chromosome 16q22-linked familial AML

Table 1. Single nucleotide polymorphisms (SNPs), primers, PCR conditions, and results of SNP detection
gene SNP
  source position in gene SNP ID (1) description (2) nucleotide hetero-zygosity (3) 5' primer 3' primer product size bp T° annealing
CBFβ public databases intron 2 rs1559368 IVS2-790C>T Y no TCTATGCATGGAAACCAATTATGC TCAACAGATGCAACAATCTAAAACC 271 59°C
    intron 3 rs1212500 IVS3-2497T>C R/R/Y no CAGTTTCTACAATCTTCCCACTCC CTCATGTTAAACAAGGTAGAGAAGACC 411 62°C
    intron 3 rs1200874 IVS3-2479G>A R/R/Y no CAGTTTCTACAATCTTCCCACTCC CTCATGTTAAACAAGGTAGAGAAGACC 411 62°C
    intron 4 rs1806435 IVS4+3488A>G Y/R no GTCAATCCAATCTGAATTTTCCTT ACTTTCTAGTGAAAAGCTTAGGATTCA 354 62°C
    intron 4 rs882821 IVS4+3477C>T Y/R no GTCAATCCAATCTGAATTTTCCTT ACTTTCTAGTGAAAAGCTTAGGATTCA 354 62°C
    3'-UTR rs1061253 R no GCAATCTGGTAGCTTAAGGCAAGT ACCATGCTGCTTCTGTCTGTCTT 205 59°C
    telomeric rs1881465 Y/R yes TCCTCACCTCTTTCGTCCTCTC TCTGTAAAATGGAAATGGGAATAACA 268 62°C
    telomeric rs1881466 Y/R no TCCTCACCTCTTTCGTCCTCTC TCTGTAAAATGGAAATGGGAATAACA 268 62°C
  Celera database centromeric CV2847588 Y yes AGCAGGCAGGACTTTTGGTATCT GTGACGAGACCCTGATCCATTT 350 59°C
    centromeric CV2847591 T/C/T no CGAGAGAGTGTTTGGAAAATTGC AGGCTTGATAGCTTCCCTAGTCC 727 59°C
    centromeric CV2847592 T/C/T no CGAGAGAGTGTTTGGAAAATTGC AGGCTTGATAGCTTCCCTAGTCC 727 59°C
    centromeric CV2847593 T/C/T no CGAGAGAGTGTTTGGAAAATTGC AGGCTTGATAGCTTCCCTAGTCC 727 59°C
    intron 3 CV2847587 IVS3+1606T>A A no TGAATAGCATAACCTGCCACATTT TTTTCCAAGCAAACAAGCTAATACAC 369 62°C
    intron 3 CV2847586 IVS3+2894A>G Y no AATCCTTGGACTTAAACCATTGAGA TGAGGGAAAGATACTGATTTCTACCA 942 62°C
    intron 3 CV2847584 IVS3+10714A>G Y no GTATTGCTGTGCTTTCAGGACTCT TGATATGGGCAGATTTGTTTATTTG 269 59°C
    intron 3 CV2847583 IVS3+11034C>T S/R no AAGTAATGAGCCATTTGGGAGAAC TGGCCAATACATTTAAGGAAAATAAAA 648 62°C
    intron 3 CV2847582 IVS3+11105G>C S/R no AAGTAATGAGCCATTTGGGAGAAC TGGCCAATACATTTAAGGAAAATAAAA 648 59°C
    intron 3 CV2847581 IVS3-13504A>T W no TCCTGATTGATGTATTTGTTCCCTT CGGACTTGACCCTAAGATTCTGTT 530 59°C
    intron 3 CV2847580 IVS3-8106C>T R no CAGTGCTATTGTAGTGCTGGAATCT CGTATTAAGAAAACGTAAGAGGGTGTG 288 59°C
    intron 3 CV2847552 IVS3-3133C>A K no TGTTTAATAACAATAACTGACTGCCAA AGTAGTGAAGGGGAATGACACAAA 440 62°C
    intron 3 CV2847551 IVS3-3126C>A K no TGTTTAATAACAATAACTGACTGCCAA AGTAGTGAAGGGGAATGACACAAA 440 62°C
    intron 3 CV2847550 IVS3-2188C>T R/R/Y no CAGTTTCTACAATCTTCCCACTCC CTCATGTTAAACAAGGTAGAGAAGACC 411 62°C
(1) for SNPs from public databases, ID refers to dbSNP NCBI SNP CLUSTER ID's available at http://www.ncbi.nlm.nih.gov/SNP/."
(2) nomenclature system for sequence variations (den Dunnen JT, Antonarakis SE; Hum Genet. 2001 Jul;109(1):121-124)"
(3) results of our study showing detection (yes) or absence (no) of polymorphism in any sample analysed; heterozygosity was detected in unaffected individual III-5 in family A only

Last modified on the 16th August 2003.
For comments regarding the content of this page, please contact or