No evidence for core-binding factor CBFβ as a leukemia predisposing factor in chromosome 16q22-linked familial AML You can buy sociology papers of your choosing at https://essays-writer.net/sociology-essays/. Our editor will contact you immediately after the order is sent.
Experimental design
Pedigrees and samples
Pedigrees, numbering of individuals, DNA and sample preparation have been described in :
Family A: Horwitz M, Benson KF, Li FQ, Wolff J, Leppert MF, Hobson L, Mangelsdorf M, Yu S, Hewett D, Richards RI, Raskind WH. Genetic heterogeneity in familial acute myelogenous leukemia: evidence for a second locus at chromosome 16q21-23.2. Am J Hum Genet. 1997 Oct;61(4):873-81.
Family B: Gao Q, Horwitz M, Roulston D, Hagos F, Zhao N, Freireich EJ, Golomb HM, Olopade OI. Susceptibility gene for familial acute myeloid leukemia associated with loss of 5q and/or 7q is not localized on the commonly deleted portion of 5q. Genes Chromosomes Cancer. 2000 Jun;28(2):164-72.
Samples used in this study were affecteds IV-1, IV-3, unaffected carriers II-5 and III-5 for family A, and affecteds III-1, III-6, unaffecteds II-3, III-2, III-7, III-8 and III-9 for family B. All individuals had given informed consent. Lymphoblastic cell lines for RNA isolation were available from individuals in italics.
Genomic Sequence, Gene Structure and Primer Design
Genomic DNA sequence and gene structure were obtained using public databases (http://www.ncbi.nlm.nih.gov/Genbank/index.html, http://genome.ucsc.edu and http://www.expasy.ch/sprot). Primers pairs were designed to amplify Single Nucleotide Polymorphisms (SNP) or exons and intronic flanking regions using Primer3 (http://www.broad.mit.edu/cgi-bin/primer/primer3_www.cgi). SNPs were identified from public databases (http://snp.cshl.org and http://www.ncbi.nlm.nih.gov/SNP) or Celera (http://www.celera.com).
PCR and Sequencing
Standard PCR conditions were used for most of the amplifications. Briefly, 50-100 ng DNA was amplified in a final volume of 50μl using 1.5mM MgCl2, 2mM of each nucleotide, 3U Taq polymerase (all from Roche Diagnostics, Mannheim, Germany), 100ng/μl of each primer (Geneworks, Adelaide, Australia), and anti-Taq antibody (Clontech Laboratories, Palo Alto, CA, USA). PCR reactions were carried out on a Peltier Thermal Cycler PTC-200 (MJ Research, Waltham MA) and included initial denaturation at 950C for 5min, then 40 cycles of denaturation at 950C for 20sec, annealing for 30sec and elongation at 720C for 30sec, and a final elongation step at 720C for 10min. The amplicons were purified using QIAquick PCR purification kit (Qiagen, Clifton Hill, Australia), sequenced in both directions using BigDye terminator cycle sequencing (Perkin Elmer Corporation) and analyzed on an ABI377 sequencer.
| CBFB: primers and special PCR conditions to amplify exons and surrounding intronic sequences | |||||
| exon | 5' primer | 3' primer | product size bp | T° annealing | special PCR conditions |
| exon 1 | GGGCGGTCAGTCGGTCAG | CCCGAAATCAGGAGCCAAATC | 392 | TD 65°C (1) | 2.5 mM MgCl2, 2% dimethyl sulfoxide (DMSO), 7-deaza-dGTP ratio 1:6 to normal dGTP |
| exon 2 | CAGCCTCTGCTTGCCCTTATCG | GAGCTCCACTCGCGGTGCTCCGTT | 429 | 62°C | 2% DMSO |
| exon 3 | CTGGCTTAAGACATAAACTGATG | CTGGTATAATCAGATCTGTGATC | 317 | 60°C | - |
| exon 4 | CTACAGAGTTTATATAAGTAAG | CCTCAATATTGCTTCAACACAATAC | 331 | 52.5°C | - |
| exon 5 | TAGGTATTTCATGTATTCTG | CACAAAGCCAGAGAGTACAACT | 263 | 52.5°C | - |
| exon 6 | GCCTGTTACATGTGACTATATTGG | GCCAACAAGGTAAGCTGGCATAG | 462 | 60°C | - |
| (1) TD, touch-down. | |||||
Semi-quantitative RT-PCR
Semi-quantitative RT-PCR was performed using RNA extracted from lymphoblastoid cell lines derived from peripheral blood from individuals IV-3 and III-5 of family A and from individuals II-3, III-1 and III-9 of family B. Total RNA was extracted from 3x107 cells using the RNeasy Midi Kit (Qiagen). cDNA synthesis was performed using 2μlg of total RNA, T7-(dT)24 primer and SuperScript II (Invitrogen Life Technologies). The product was cleaned up using the GeneChip Sample Cleanup Module (Qiagen) and subsequently used for PCR. Full length CBFβ cDNA was obtained using primers 5'-GTCAGTCGGTCAGCGCGGAGC and 3'-ACGAAGTTTGAGGTCATCACCA. PCR was carried out using the described standard conditions, with increasing cDNA dilutions up to 1:3000.
Northern Blots
Northern Blots were performed following standard procedures. RNA was extracted from 107 cells, and for each sample, 10μg of RNA was used for blotting. Template for probe generation was generated as following: full length cDNA obtained by RT-PCR was inserted into plasmid vector pcDNA3 (Invitrogen) using primers containing a restriction site for EcoRV. Radiolabelled probe covering the full length cDNA was then generated by PCR using the following primers: 5'-GTCAGTCGGTCAGCGCGGAGC and 3'-ACGAAGTTTGAGGTCATCACCA.
FISH
Cytogenetic harvest of lymphocytes was performed according to routine protocol (Espinosa,R. Gene mapping by FISH. Methods Mol.Biol.,68:53-76, 1997). Briefly, slides were prepared by dropping the cell suspension onto clean moist slides. Immediately prior to hybridization, slides were treated with RNAse in 2xSSC at 370C for 1hr, washed sequentially in 2xSSC, 70%, 80%, and 95% ethanol at room temperature and then denatured at 750C in 70% formamide/30% 4xSSC for 2 min. prior to washing in graded alcohol for a second time. Slides were kept at 400C until hybridization was completed. Test probes were labeled by nick translation with inclusion of biotin labeled dUTP (Boehringer-Mannheim) and the control probe was nick translated with digoxigenin labeled dUTP. Probes were detected using avidin-FITC or anti-digoxigenin-Rhodamine, and counterstaining was performed with DAPI. Image capture was performed with a Photometrics CCD camera and image enhancement was performed with Adobe PhotoShop. At least 60 metaphases were analyzed. Locus specificity was confirmed on FISH hybridization to metaphase spreads of normal human lymphocytes.
| BAC clones used in FISH experiments: | |||||
| BAC | Library | Accession | Gene coverage | Insert size | |
| CBFB | RP11-361-L-15 | RPCI human BAC library 11 | AC009084.9 | exons 1-4 | 183 kb |
| RP11-5-A-19 | RPCI human BAC library 11 | AC074143.5 | exons 3-6 | 152 kb | |
| chr16p | RP11-50-D-22 | RPCI human BAC library 11 | control BAC chr16p | 156 kb | |
| RP11-66-H-06 | RPCI human BAC library 11 | control BAC chr16p | 167 kb | ||
Last modified on the 12th February 2004.
For comments regarding the content of this page, please contact or